Principles of Medical Ethics 

Before You Donate

Think very seriously before donating to any breastcancer organization, or fundraising program until you read their Annual Report to see who their top contributors are, and if they have a product that appears frequently in the message the organization sends to the public. That would be unethical and its illegal. The same applies to a request that the public buys products, but does not receive a "donor receipt" for tax-deductible purpose. Read any and all food labels that breastcancer "non-profits" are promoting to raise money. Some organizations tell the public to help them raise money by asking you to visit their websites, but that only gives them "hits" to increase their sponsors.

Another tip, "signing" an online Petition is not acceptable, so don't fall for such antics. An ethical non-profit, or professional will not request your visit to their website, nor use "cookies" placed on your computer when you visit their site.

Purchase the Breastcancer Postage Stamp, the Post Office will always give you your charitable deduction receipt. Its a valid form of fund raising.

 

 

This Is About Ductal Lavage! 

Detection of breast cancer cells in ductal lavage fluid by methylation-specific PCR

 The Lancet

http://www.thelancet.com/journal/vol/iss/full/llan.357.9265.original_researc
> h.16047.1

Ella Evron, William C Dooley, Christopher B Umbricht, Dorothy Rosenthal, Nicoletta Sacchi, Edward Gabrielson, Angela B Soito, David T Hung, Britt-Marie Ljung, Nancy E Davidson, Saraswati Sukumar

If detected early, breast cancer is curable. We tested cells collected from the breast ducts by methylation-specific PCR (MSP). Methylated alleles of Cyclin D2, RAR-ß, and Twist genes were frequently detected in fluid from mammary ducts containing endoscopically visualised carcinomas (17 cases of 20), and ductal carcinoma in situ (two of seven), but rarely in ductal lavage fluid from healthy ducts (five of 45). Two of the women with healthy mammograms whose ductal lavage fluid contained methylated markers and cytologically abnormal cells were subsequently diagnosed with breast cancer. Carrying out MSP in these fluid samples may provide a sensitive and powerful addition to mammographic screening for early detection of breast cancer.

The recent decline in breast cancer mortality rate is due, in part, to early diagnosis by screening mammography. However, given the well-recognised limitations of mammography,1 further advances for early breast cancer detection are clearly needed.

We previously identified a number of genes that had lower expression in breast cancer than in healthy mammary epithelial cells using serial analysis of gene expression (SAGE) and microarray analysis of primary breast cancers. Many of these genes were silenced by hypermethylation of promoter sequences.2,3 Sensitive methods of detection of methylated alleles have now enabled non-invasive detection of small numbers of cancer cells.4 We searched for genes that were hypermethylated in more than 30% of breast cancers,2,3 but unmethylated in healthy mammary epithelial cells, mammary stroma, and white blood cells. Three genes fulfilled this criteria: Cyclin D2,2 RAR-ß,3 and Twist (Genbank accession number 003986). We found a cumulative incidence of methylation of the three genes in 48 (96%) of 50 surgically excised primary breast tumours and in eight (57%) of 14 of the ductal carcinoma in situ (DCIS) lesions. This analysis highlights the high sensitivity and specificity of a MSP-based test for breast cancer and raises the possibility that it could be applied to the detection of cancer cells in body fluids.

Because most breast cancers arise from the ductal epithelium, atypical and malignant cells can be found in breast ductal fluid. We used two techniques to collect ductal fluid: Routine Operative Breast Endoscopy (ROBE) and ductal lavage. ROBE allowed direct visualisation of macroscopic changes in the ductal epithelium,4 and recovery of irrigation fluid from the catheter. Ductal lavage through a microcatheter; (Pro·Duct Health, CA), enabled collection of breast epithelial cells from the entire ductal tree. We cannulated the individual orifices with a small flexible microcatheter, and up to 20 mL of saline was introduced in incremental volumes to flush out epithelial cells from the ducts and lobules. The ductal fluid was placed immediately in cytology fixative and prepared with standard millipore filtration devices for cytology assessment and DNA extraction.

We recruited 37 women with biopsy-proven cancer. Women underwent ROBE immediately before definitive surgery and after signing an informed consent form. DNA from both the ductal fluid cells and the matching surgical samples was tested with methylation-specific PCR (MSP) for Cyclin D2, RAR-ß, and Twist.2,3

Methylated alleles of at least one of three markers were detected in 17 of 20 irrigation fluid samples from patients with pathology-confirmed invasive carcinoma (table). Healthy breast tissue contained only unmethylated genes (zero samples of 20; table). Methylated alleles for RAR-ß only were noted in two of 56 samples (table).


Diagnosis

Cyclin D2

RAR-ß

Twist

Overall methylated*

Tissue

n=140

n=140

n=140

 

Invasive breast cancer

25/50

17/50

21/50

48/50 (96%)

Ductal carcinoma in situ

4/14

7/14

4/14

8/14 (57%)

Normal breast tissue

0/20

0/20

0/20

0/20 (0%)

White blood cells

0/56

2/56

0/56

2/56 (4%)

ROBE fluid

n=35

n=37

n=34

 

Invasive breast cancer

8/19

12/20

13/18

17/20 (85%)*

Ductal carcinoma in situ

2/6

1/7

0/7

2/7 (29%)

Atypical ductal hyperplasia

1/6

2/6

1/5

2/6 (33%)

No residual tumour

0/4

0/4

0/4

0/4 (0%)

Ductal lavage fluid

n=56

n=56

n=46

 

Benign

3/45

2/45

0/35

5/45 (11%)

Atypical with mild changes

0/5

1/5

0/5

1/5 (20%)

Atypical with substantial changes

3/5

2/5

0/5

3/5 (60%)

Malignant

1/1

1/1

0/1

1/1 (100%)

ROBE=routine operative breast endoscopy

*The number of overall methylated markers was significantly higher in malignant cases (invasive breast cancer and DCIS) than in non-malignant cases (healthy breast tissue, atypical ductal hyperplasias, and in samples from patients with no residual tumour; p <0·01 by Pearson's x2). The number of overall methylated markers was significantly higher in cases classified as "atypical with marked changes" and "malignant", than in cases classified as "benign" and "atypical with mild changes" (p <0·01 by Pearson's x2).

Assessing the use of methylation markers for early detection of breast cancer


By contrast, irrigation fluid from four patients who underwent re-excision, but were subsequently found to be tumour-free, contained only unmethylated markers (table). Irrigation fluid from two of seven patients with DCIS (Grade 1-3), and two of six patients with atypical ductal hyperplasias contained hypermethylated markers. DNA samples from 19 of the 20 excised tumour samples were positive by MSP for the presence of methylated markers. Analysis of the irrigation fluid thus missed two MSP-positive samples, presumably because of the low cell yields. Cytology analysis on this fluid was inconclusive in 23 samples due to inadequate cellularity, and no malignant cells were detected in the remaining samples. These results suggest that MSP is sensitive, as the techinique detected cancer cells in 85% of ductal fluid samples from patients with breast malignancy, including cases where the material was inadequate for cytology.

We extended our analysis to 56 samples of ductal lavage fluid (obtained after informed consent) from women with non-suspicious mammograms and breast examinations, but at high risk for developing breast cancer (as defined by a Gail index ge1·7, previous history of contralateral breast cancer, or BRCA1 and BRCA2 mutations). Using cytopathology, 50 samples were classified as benign or with mild changes, and six samples were classified as atypical with substantial changes or frankly malignant (figure 1). Among the cases with substantially abnormal cells or malignant cells, four of six samples were identified by MSP (67% sensitivity), whereas only five of 45 benign cases were positive (89% specificity; figure 2). Pathologically confirmed breast cancer was subsequently diagnosed in two women with abnormal cytological findings and MSP-positive ductal lavage fluid. A third patient in this category is undergoing further assessment. These cases indicate the promising potential of the MSP-based method for early detection of breast malignancy, before the appearance of suspicious findings on mammography.                                                                                           

01 let/4015(F2)

Figure 1: Cytological analysis of ductal lavage fluid

A: benign cells. B: atypical with mild changes. C: atypical with substantial changes. D: malignant cells.

 

01 let/4015(F1)

Figure 2: MSP profiles of ductal lavage fluid

U=unmethylated. M=methylated. 231=breast cancer cell line MDAMB 231. From women with invasive cancer and "malignant" cytology, and two women with ductal carcinoma in situ (DCIS1, DCIS2) and a cytology diagnosis of "atypical cells with marked changes". MSP primer sequences were: RAR-ß: U Forward-5'GGATTGGGATGTTGAGAATGT3'; U Reverse-5'CAACCAATCCAACCAAAACAA3'; M Forward 5'GAACGCGAGCGATTCGAGT3'; M Reverse-5'GACCAATCCAACCGAAACG3'. Twist: U Forward-5'TTTGGATGGGGTTGTTATTGT3'; U Reverse 5'CCTAACCCAAACAACCAACC3' M Forward-5'TTTCGGATGGGGTTGTTATC3'; M Reverse-5'AAACGACCTAACCCGAACG3'. Cyclin D2 analysis has been previously described.2

MSP confirmed the cytological finding that led to the diagnosis of breast cancer in two women. In combination with cytology evaluation, MSP of ductal lavage could provide a useful adjunct to mammography in the early diagnosis of breast cancer.

We thank Kyle Terrell and Heather Lewin, Indira Debchoudhury, and Dorian Korz for assistance; Bert Vogelstein, David Sidransky, Donald Coffey, and Alan Rein for reviewing the paper; and the Arthur and Rochelle Belfer Tissue Bank, Susan G Komen Foundation (BCTR 2000 577 to SS), The American Breast Cancer Foundation, and the NIH P50 CA88843 for grant support.

1 Elmore JG, Barton MB, Moceri VM, Polk S, Arena PJ, Fletcher SW. Ten-year risk of false positive screening mammograms and clinical breast examinations.  N Engl J Med 1998; 338: 1089-96. [PubMed]

2 Evron E, Umbricht CB, Korz D, et al. Loss of cyclin D2 expression in the majority of breast cancers is associated with promoter hypermethylation.  Cancer Res  2001; 61: 2782-87. [PubMed]

3 Sirchia SM, Ferguson AT, Sironi E, et al. Evidence of epigenetic changes affecting the chromatin state of the retinoic acid receptor beta2 promoter in breast cancer cells.  Oncogene 2000; 19: 1556-63. [PubMed]

4 Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands.  Proc Natl Acad Sci USA 1996; 93: 9821-26. [PubMed]

5 Dooley WC. Endoscopic visualization of breast tumors. JAMA 2000; 284: 1518.


Johns Hopkins University School of Medicine, Baltimore MD 21231, USA (E Evron, MD, W C Dooley MD, C B Umbricht MD, D Rosenthal MD, N Sacchi PhD, E Gabrielson MD, N E Davidson MD, S Sukumar PhD); UCSF School of Medicine, San Francisco, CA (B-M Ljung MD); and Pro·Duct Health, Menlo Park, CA (A B Soito BS, D T Hung MD)  

              Entered 7/2001   Rev.07/02/2005                                                                                                            Webmaster